| Trans | Internet-Zeitschrift für Kulturwissenschaften | 16. Nr. | Juli 2006 | |
|
5.6. Border Zones: Travel, Fantasy and Representation Herausgeberin | Editor | Éditeur: Ludmilla Kostova (University of Veliko Turnovo, Bulgaria) |
||||
Oliver S. Müller (University of Namibia, Windhoek, Namibia)
[BIO]
Although the literary scene of Luxembourg has been developing for decades, it has rarely been recognized beyond its borders. Authors from Luxembourg, writing in German, French, Italian, and Luxembourgish, are seldom read beyond Luxembourg. As Kramer has noted,
die berühmte Globalisierung, die alle Bereiche des Lebens zu erfassen beginnt, macht - zumindest in Europa - vor der Literatur weitgehend halt: Ihre Produktion bleibt an die Sprachgrenzen, die ja meistens auch Nationalgrenzen sind, gebunden, und ihre über diese Grenzen hinausgehende Rezeption hängt, wenn wir einmal von der Weltkommunikationssprache Englisch absehen, weitgehend vom Vorhandensein von Übersetzungen ab. (28)
the famous globalization that starts to encompass all spheres of life has its limits - at least in Europe - when it comes to literature: Its production is restricted to linguistic boundaries, which are mostly also national boundaries. Its reception depends, with the exception of English as the world language, largely on the existence of translations.(2)
Similarly, Georges Hausemer notes that
Auf der europäischen Landkarte der Literatur ist Luxemburg nicht einmal in Umrissen vorhanden. Ein weißer Fleck, ein Vakuum, das außerhalb des Großherzogtums nur wenige Eingeweihte mit Autorennamen und Werktiteln zu füllen wissen. (1)
On the European literary map, Luxembourg is not even outlined. A white dot on the map, a vacuum that only few insiders know how to fill with names of authors and titles.
The fact that only very few authors from Luxembourg have had success abroad is surprising for a number of reasons. First of all, the literary market of Luxembourg, which has a population of approximately 463,000, is in most cases too small for professional authors to make a living. It would therefore be economically logical to target a readership in its bigger neighbor countries like France and Germany. Furthermore, prominent topics in literature from Luxembourg often relate not only to Luxembourg but also encompass themes relevant to other European nations. Thirdly, the high productivity of the literary scene has produced a number of highly innovative authors.
Roger Manderscheid can help illustrate this dilemma. Manderscheid’s semi-autobiographical novel Schacko Klak: biller aus der kandheet (1935-1945) (1988) explores the troubled relationship between Luxembourg and Nazi Germany. Although written in Luxembourg, a German translation makes it easily accessible to German readers. Nevertheless, Schako Klak and Mandesheid’s other texts, many of which were originally written in German, have not made their way onto the mainstream literary scene in Germany.
A recent exception has been Guy Helminger. Writing short prose, novels, theater plays and poetry in German, Helminger was awarded the prestigious 3-sat-Preis in 2004 and subsequently was signed on by the German Suhrkamp Verlag. While Guy Helminger was born in Luxembourg, he has lived in Cologne, Germany, since 1985. It could thus be argued that he is just as much part of the literary scenes of Luxembourg and Germany.
One author whose works can help demonstrate the complexities of literature from Luxembourg and provide proof positive of its maturity is Nico Helminger. Born in 1953 as the older brother of Guy Helminger in the small city of Differdingen (Déifferdang, Differdange) (population approximately 5 400), Luxembourg, Nico Helminger studied German, Romance languages and literature and theater studies in Luxembourg, Germany and Austria. Later, he lived in Paris for twenty years before returning to Luxembourg, and was writer-in-residence in Iowa, USA. Helminger has published in a wide variety of literary genres, amongst others, poetry, a novel, short prose, theater plays, radio drama, and libretti, mostly writing in Luxembourgish and German.
In his poetry, however, Helminger fuses the multilingualism of Luxembourg into his writings by frequently employing English, Luxembourgish, French and Italian besides the dominant German. For example, in his book grenzgang, a number of French "poems" are included that Helminger calls "texte trouvé". Helminger wrote these texts during his time in Paris, but, according to the author, forgot about them and only re-recovered them much later in his attic. The multilingualism of Helminger’s poetry is only one of multiple instances in which the author trespasses literary or linguistic boundaries.
While Helminger is thus one of the most versatile authors from Luxembourg - the British Broadcasting Corporation (BBC) referred to Helminger as "one of the leading European writers" in 2001 and Alfred Strasser has called him "the fixed star" on the literary scene of Luxembourg - his remarkable literary output has attracted little attention in academia. This is both the case in Luxembourg and in Germany. One exception has been the literary critic Michel Raus from Luxembourg and an article in the recently published book Über Grenzen. Literaturen in Luxembourg in which Helminger explains some of the key concepts of his work. A comprehensive literary study, however, has not been published yet. This paper, therefore, hopes to initiate an academic debate about the work of Nico Helminger and other writers from Luxembourg who are enjoying literary renown beyond the border of their country.
Whereas Nico Helminger’s prose and drama are primarily written in Luxembourgish, the majority of his poetry is in German. This paper will analyze his highly complex and multi-layered poetry. Of special importance will be the question of how Helminger’s poetry transgresses traditional literary boundaries. Identity is central the analysis of literature from Luxembourg. How does Helminger, then, construct notions of identity such as self and other? Furthermore, it will be important to delineate which methods are employed in this process and how Helminger achieves innovative forms through reproduction and alterations.
It is the aim of this paper to contribute to the academic debate about German-Luxembourgish poetry, which has only recently been revived with the publication of a collection of critical essays and interviews on Luxembourgish literature in Honnef-Becker/Kühn. Similarily, in 2003 Romain Hilgert criticized the fact that no history of German-Luxembourgish literature exists, which he attributes to a lack of academic interest in the topic. This article is therefore an invitation to further explore the fascinating topic of Luxembourgish literature in general and specifically of German-Luxembourgish poetry.
Nico Helminger’s poetry can roughly be divided into two periods. The first period dates from 1979, the year of the publication of his first collection of poetry (einer blättert im fahndungsbuch) and includes the following collections landschaft mit seilbahn (1986), hugo’s balls (1992) and patton & co (1992). The beginning of the second period can be traced back to the publication of in eigener säure (1997) and also includes Helminger’s latest collection of poetry called grenzgang (2003). Whereas until 1997, Helminger’s poetry can be described as traditional, a clear shift occurs with the publication of in eigener säure. This change is expressed by Helminger’s own categorization in which he discards the traditional terminology "poems" for "sequences".
As Helminger explains, the term sequence has multiple meanings (Honnef-Becker/Kühn, 212). On a surface level, it derives from the Latin word sequentia, which means a series of something. Sequences as a literary form have been known since the ninth century and were originally songs of appraisal and jubilation without lyrics. It was only later that lyrics were added to these songs. Helminger is aware of the musical and religious origin of sequences. By re-employing the term sequences, Helminger, therefore, places his poetry in line of a century-old literary tradition. On the other hand, he simultaneously rejects this tradition by secularizing his sequences. The musical aspect of the sequences is kept, however. As Helminger explains, he strives to incorporate musical themes into his poetry (Honnef-Becker/Kühn 213). In grenzgang, for example, Helminger quotes the twentieth century American composer Charles Edward Ives (1874-1945) whose music trespasses traditional musical genres and uses motifs of such contrasting musical traditions as church music, folk music and military marches while simultaneously experimenting with polytonality. For example, Helminger incorporates the structures of sonatas into his poetry. This becomes particularly evident in his public readings when sequences with a fast pace interchange with the slow pace of other parts. Rhythm and text thus refer to each other, creating a hermeneutic circle in which the reader is faced with a dilemma: To understand the meaning of the text as it is conveyed by the words, it is necessary to understand the underlying musical rhythm. The latter, however, can only be comprehended through an understanding of the words.
The change from poems to sequences is also mirrored on a formal level with a rejection of traditional poetic forms, i.e. distinct/separate poems that can be divided into stanzas and verses. Instead, Helminger creates a poetic network in which each line refers back to other parts, thus creating a non-linear lyrical structure without beginning or end. The complexity that is achieved thus parallels the structure of a DNA-sequence. In a self-reference to the structure of the text, Helminger decodes his method by quoting the following DNA-sequence at the beginning of in eigener säure:
GAGTTTTATCGCTTCCATGACGAAGTT
CCATGTAATGCTTAACTATGCGCGTAG
ATATGAGATCCATCGCATATCCAGTAC (5)
Helminger explains that "die ‘Folge’ der Texte wichtig ist, das Schritt für Schritt sich weiter bewegen und entdecken" ("the arrangement of the texts is important, the moving-on and discovering, both of which go step by step") (Honnef-Becker/Kühn 2004, 212f.). Similarly to a DNA molecule, the meaning of the text lies not just in the denotation of the words but also in their arrangement. For readers, the process of (re)constructing the meaning of the text, therefore, requires them to translate the sequences in the same way that DNA is translated during the synthesis of proteins.
By employing DNA structures for his sequences, Helminger thus challenges the reader to look for hidden meaning beyond the surface level. These high expectations cannot be met in all instances as another example from in eigener säure illustrates. In "nagauta 6", Helminger not only employs the Japanese musical genre of nagauta, he also combines it with DNA sequences. The beginning of "nagauta 6" reads as follows:
windsTille dämmersTunde
im kopf unTerm blAssen
doTTer Aus milChGlAs
vorGeformTes Gefunden
und neu formulierT
Als vorläufiGes bündnis
von lAndsChAfT und iCh
GeGen den Tod (Helminger 1996, 83)calm dusk
in the head under a pale
yolk of milkglass
found preshaped
and formulated anew
as temporary alliance
of landscape and me
against death(3)
In this example, the lyrical-I describes the creative process of trying to derive at meaning. This seems to be achieved on the one hand through an interaction with nature ("Als vorläufiGes bündnis/von lAndsChAfT und iCh"). It is important to note that the alliance between nature and lyrical-I is only temporary ("vorläufig") and thus only offers a momentary victory over death. On the other hand, meaning is also obtained by re-employing and re-formulating pre-existing texts (both real as well as imagined texts). Helminger thus places himself into the tradition of the postmodernist critic Frederic Jameson who declared that "the writers of the present day will no longer be able to invent new styles and worlds ... only a limited number of combinations are possible; the most unique ones have been thought of already" (Jameson 59). In this way, the DNA-sequence serves as a metaphor. While there is a limited set of signs and forms to choose from, present-day writers are free to combine and alter them.
Whereas readers will not be able to translate each nucleotide in the above example into specific meaning, the symbolic meaning of the concept of employing DNA sequences is an important tool in understanding the text. The thesis put forward in Honnef-Becker/Kühn that these quotes are a "selbstbezügliches, autoreferentielles Sprachspiel, das demonstriert, wie Sprachmaterial Sprachmaterial generiert" ("self-referential language game that shows how language material generates language material") (209) offers a too narrow explanation. The over-emphasis on the process of "generating language material" results in an omission of the semantic aspect of what the newly generated "language material" means or symbolizes.
Helminger employs the postmodernist technique of re-combining existing literary forms and of using different genres and styles widely. This is particularly evident through his incorporation of various lyrical traditions from different cultures. Whereas landschaft mit seilbahn frequently experiments with the traditional European form of the sonnet, in eigener säure displays Helminger’s intimate knowledge of Japanese literary traditions. Instead of naming the sequences according to their content, Helminger simply calls them nagauta and numbers them from one to seven. Nagauta are long, poetic Japanese songs that are often accompanied by a lute(4). Once again, this implies an inherent musicality for the sequences. Similarly, Helminger stresses the importance of the Japanese literary forms of haiku and tanka (Honnef-Becker/Kühn, 212). However, Helminger does not simply imitate or reproduce these forms, but experiments and changes their structure. Whereas, for example, he keeps the traditional structural form of the traditional tanka by using five verses, he breaks with the convention of alternating between five and seven syllables per line. As with the western form of sequentia, Helminger thus overcomes the stringent formal conventions to derive at new and innovative literary forms.
A third literary form that Helminger employs is the palimpsest. This becomes particularly evident in the sequence of the same name in grenzgang. Helminger explains his use of palimpsest as a
Metatext ..., der sozusagen das literarische Verfahren bloßlegt. Die verschiedenen Schichten, die ich beschreibe im Text, auch in den Landschaftsbeschreibungen, die sind ja hier auf das Literarische bezogen. Der erste Teil ist eine Art Textblock oder vielleicht Magma, wo man sehr schwer hineinkommt, da ist alles dicht beschrieben. Und je mehr man kratzt - so wie früher ja auch immer die Papyrusrolle wieder abgeschabt wurde - desto tiefer dringt man zu neuen Schichten vor. So wie ich zu anderen Schichten vordringe, stoße ich natürlich auf die Literaten, die mich interessieren, die Schriftsteller, die vorher da waren, und die ich für mein Schreiben brauche, ohne die ich nicht schreiben kann. (Honnef-Becker/Kühn 2004, 215f.)
metatext that discloses the literary process. The different layers that I describe in the text, also the ones in the descriptions of landscapes, are here related to the field of literature. The first part is a kind of text block or perhaps also a magma, where it is hard to get to, everything is densely written. The more you scratch, the way it used to be done with the papyrus, the deeper you get to new layers. As I reach other layers, I also find other writers that interest me. These are the writers who were there before and whom I need for my writing.
Although Helminger stresses that he does not expect readers to reach all levels, he clearly presents them with the challenging task of uncovering the hidden text that lies underneath the surface level. In this respect, readers are assigned the job of archeologists in recovering the hidden texts of these palimpsests.
But what exactly can readers hope to find underneath the surface text? One of the most striking features of Helminger’s poetry is its inherent intertextuality. Examples can already be found in the early collection of landschaft mit seilbahn. Here, quotes from the Austrian author Rainer Maria Rilke abound. The relatively long poem "dreckiges Gedicht nummer 3" ("dirty poem number 3"), for example, incorporates at least five quotes from Rilke’s Duineser Elegien (Duineser Elegies). This extensive quoting can be equated to a dialogue between Helminger’s poem and the texts he quotes from. Only by taking into consideration the quoted texts can readers reach beyond the surface level. Helminger’s "dreckiges Gedicht nummer 3", for example, is placed into the tradition of the literary genre of elegies. The tone of resignation or moaning that is a characteristic feature of elegies thus sets the tone for interpretation.
Whereas this kind of intertextuality is comparatively rare in Helminger’s early poetry, it becomes a dominant characteristic in grenzgang. Here, he quotes extensively from writers such as Rilke, Henry David Thoreau, Ralph Waldo Emerson, Amelia Rosselli, Jean-Michel Espitallier, Friedrich Gottlieb Klopstock, Paul Celan or Robert Walser (see. Honnef-Becker/Kühn 208).
These quotes add a substantial degree of meaning to the texts. By extensively quoting Emerson and Thoreau, for example, Helminger places his literature in the tradition of the American transcendentalists. By employing the word "sauntering" from Thoreau’s essay "Walking" as a leitmotif throughout "palimpsest" and grenzgang, Helminger not only refers back to the transcendentalists’ maxim to live in harmony with nature, but also comments on his own way of writing. According to his own testimonial, Helminger usually composes his texts while walking in nature. The rhythm that is evident in his texts, Hemlinger explains, can be seen as a mirror of the rhythm that he encounters while walking. This leads to the declaration: "Ich schreibe mit dem ganzen Körper" ("I write with my whole body") (Honnef-Becker/Kühn 214).
Helminger’s association with the American transcendentalists is not as straightforward as it might seem, though. Once again we encounter how Helminger re-employs the original concept. (5) According to Zapf, American transcendentalism can at its broadest be seen as a literary, philosophical, religious, and social reform movement that is primarily concerned with spiritual questions whereas nature is often glorified as a spiritual source for self-fulfillment (101). Furthermore, transcendentalists show a tendency to go beyond existing literary conventions by employing literary techniques that transcend traditional literary boundaries (ibid.). According to Zapf, their lasting influence on contemporary literature and philosophy can be explained by their emphasis on the self-realization of the individual and their utopian optimism for the future (ibid.); while Helminger embraces the notion of nature as a spiritual resource both for himself as a writer and as a leitmotif in his poems. Furthermore, his transcendence of literary genres with which he challenges preconceived concepts of literature also places him in line with the American transcendentalists. On the other hand, Helminger does not share their optimism for the future. On the contrary, his poetry often displays an inherent pessimism in the present and future as the following example illustrates:
SAGEN wir
: hier gehts
um stamm und stab
um die sich ums
und aus dem fleisch
schlängelnde sprache
flesh and flash
back to
my sugar-phosphate
back-bone of DNA
(als könnten wir dem tod
ein schnippchen schlagen
als seien wir
nicht längst eingeholt
vom schweigen das
aus all diesen worten spricht)da habt ihr
die wortballungen
die brombeerklumpen
ätsch! H acid säure
mein wesen
in vier buchstaben
ATGC ich
four letter word
fucking existence!
und auch das beste meskalin
verwandelt den schreibtisch
nicht in den baum
der erkenntnis
(zurück?)was anderes
hattest du erwartet?
so’n biß in den apfel ist
-von sichtbarem (fleischweiß
und gaumenblut) einmal abgesehen -
doch ein ausgesprochen
nostalgischer akt....
auf evas futton z.b.
paarung nach art
wiegengeschichte
von ader zu ader
mütter münder mündungen
stimmbänder des kleinen y
und a! und o! einer um-
welt as they call it
the ci-evil-ized world (Helminger 1996, 33-35)SAY
: this is
about trunk and wand
about the wound around
and out of flesh
winding language
flesh and flash
back to
my sugar-phosphate
back-bone of DNA
(as if we could
fool death
as if we were
not already overtaken
by silence that
speaks in wordsthere is your
congestion of words
the blackberry blob
ha-ha! H acid acid
my being
in four letters
ATGC I
four letter word
fucking existence!
and even the best mescaline
does not revert the desk
back into the tree
of knowledge
(back?)what else
did you expect?
ignoring that a bite into the apple is
-visible (flesh white
and gum blood) -
after all a pretty
nostalgic act
on Eve’s futon e.g.
species breeding
story of the cradle
from vein to vein
mothers mouths muzzle
vocal chord of the small y
and a! and o! of a en-
vironment as they call it
the ci-evil-ized world
Here, as in many other instances, the underlying pessimism that historical advancements always have a dialectical downside is apparent. In grenzgang, for example, industrialization is linked to destruction of the environment. Similarly, the pun on civilization in the example above shows a deep pessimism about the progress of the human race. Furthermore, Helminger seems to indicate that human beings have lost their ability to utilize language in a meaningful way. On the contrary, words only convey silence; words are added to each other to form an accumulation or congestion of words ("wortballungen") similarly to blackberry blobs in blackberry jam. While the writer can try to overcome the inadequacies of language by coining new words, the pessimistic tone of this passage suggests that he or she will ultimately fail.
There might be, however, alternative readings. By coining new words, Strasser argues, Helminger is able to create new, meaningful, self-explanatory words (68). Indeed, granzgang offers more positive assessments of the writing process, for example when Helminger writes
embuscade am busch
diese spitze dieser schreibende
dorn süsskleine haiflosse
aus dem grün heraus
und passend dazu schlägt das laub
wellen um deine vergesslichen
hände denkst du um
deine welke haut
aus der sich jetzt
dieser kleine schmerz löst
dies heilende
dieser tropfen
auf dem weg zur rose (45)embuscade at the bush
this point this writing
thorn sweetsmall shark-fin
out of the green
and fittingly foliage creates
a stir on your forgetful
hands do you think on your
worn-out hands
which is now
healed from dull pain
this healing
of the drops
on its way to be a rose
In this example, which again imitates the form of a double-helix, Helminger describes the writing process as a healing procedure in which pain can be transformed into beauty. By swaying between deep-felt pessimism and cautious optimism, Helminger achieves creativity und innovation, but uses the deconstructed language material
um aus der heftigen, wütenden Reibung der Scherben und Splitter untereinander mitunter giftige, mitunter brillante, mitunter glibbrige Funken zu schlagen, um sich gewissermaßen mit in ultimo geretteteten [sic] Versatzstücken eine neue, eine eigne Sprachheimat zu schaffen. (Raus)
to light poisonous, sometimes brilliant, sometimes slimy sparks out of the violent, angry friction of broken glass and splinters, to create a new place for his language from hackneyed-phrases.
When discussing the crossing of literary boundaries in fiction from Luxembourg, the existence of physical as well as psychological boundaries cannot be ignored. Honnef-Becker/Kühn, for example, state that
zu den zentralen Themen einer Literatur, die an der Schnittstelle verschiedener Kulturen angesiedelt ist, zählt die Reflexion über das Eigene und Fremde. Das Fremde kann dabei sowohl auf das kulturell Andere als auch auf Fremdheitserfahrungen innerhalb der eigenen Kultur bezeichnet werden. Hieraus ergibt sich als zentrale Frage, was Autorinnen und Autoren mit unterschiedlich kulturellen Hintergründen als ‚fremd’ wahrnehmen und was das ‚Eigene’ für sie bedeutet. (10)
among the central topics of a literature that is located at an intersection of different cultures is the reflection about the self and the other. The other can either relate to the cultural other as well as to experiences of the other in one’s own culture. From this follows the question what authors from different cultural backgrounds experience as other and what self means for them .
The question of how Helminger describes the dichotomy between ‘self’ and ‘other’ is - not surprisingly - quite complex. On the one hand, the Minett region of Southern Luxembourg does play a predominant role in his collections of poems and sequences. This traditionally industrialized region serves as a leitmotif. In nearly every instance, Helminger depicts a region that has been deeply transformed by human beings but that is being retaken by nature in a slow but gradual process. An early example is the poem "landschaft mit seilbahn" ("landscape with cable railway") in which Helminger writes
die blätter braun und orangengelb
vermischen sich
mit rauch braun und orangengelb
du drehst der stadt den rücken
zwischen den bäumen stehen schlote
unter dem glitschigen laub
lauern die wannen
manche mit abfall gefüllt
eingefallene erde
aufgedeckte gänge
du stehst auf dem grubendach (Helminger 1986, 9)the brown and orange-yellow leaves
mixed
with brown and orange-yellow smoke
you turn your back to the city
between the trees stand chimneys
under the slippery leaves
the tubs are waiting
some filled with garbage
sunken soil
uncovered tunnels
you are standing on the roof of a mine
Here, as in many other examples, the ambivalence of nature vs. modernism/industrialization is evident. It is the narrator who searches for traces of the clash between nature and mankind but also for signs of the ability of nature to recover.
Although Helminger frequently alludes to the Minett region, it would be wrong to label Helminger as a regional writer who is mainly interested in depicting local color. On the contrary, questions about identity in a highly globalized world abound especially in grenzgang. "I consider myself a nomad, my poems are nomadic," (Helminger 2001) is one of his most famous quotes. Grenzgang can be read as a home-coming to the region of one’s childhood. But this region, clearly discernible as the Minett region, has changed drastically. The once thriving region has seemingly become a wasteland. The memories - "zuckerbohnenparadis ihrer kindheit" (30) ("paradise of sugar beans") - are too vague to be trusted. The process of returning to one’s roots, therefore, is depicted as a highly problematic venture. The most difficult aspect is to make sense of what one finds. Language as it is traditionally used, both in oral and written forms, is of limited use - "diesen sprachwuchs auf der zunge und auch die unzulänglichkeiten" (61) (" this language cluster on the tongue and also these shortcomings") . It is only possible to make sense of these problems by breaking with traditional structures, e.g. by coining new words or re-employing and altering traditional literary forms.
It is not surprising, though, that even these innovations cannot keep a nomad in one place for long. That is why the transitory character of the sequences in grenzgang remains until the end. In "so what?", the final sequence in grenzgang, the narrator thus explains his decision not to stay in the past but to move on to new destinations when he writes "als ich ausholte zum mich-neu-aufmachen" (133) ("when I decided to start again"). His movement along and across borders - literary, psychological and physical borders - continues.
Conclusion: Modernism, Postmodernism and Beyond
Nico Helminger’s poetry combines both traditional and innovative elements. It employs literary and musical forms from eastern and western traditions from various epochs, but at the same time rejects their traditional formal conventions. It attracts readers (and listeners) on account of its musicality while at the same time alienating them because of highly complex language. It derives meaning through the "sequencing", i.e. the order in which the sequences appear, but also calls for a non-linear reading. While reflecting on the local Minett region, it probes modern and postmodern notions of identity in a globalized world. It is optimistic and pessimistic about present-day social organization. All of these contrasts result in the exceptional complexity of his poetry. He is neither a modernist nor a postmodernist writer, although he employs strategies from both trends. He is both a local author with an interest in the global and a global poet writing about the local. He re-visits and questions preconceived notions but does not offer easy answers. What he expects of his readers is to "break open" ("aufbrechen") and look what is hidden behind the surface. It is the hope of this paper that many readers, literary critics and academic researchers will do so.
© Oliver S. Müller (University of Namibia, Windhoek, Namibia)
NOTES
(1) This article is a revised version of a paper presented at the international conference " Innovations and Reproductions in Cultures and Societies (IRICS) in Vienna, December, 9-11, 2005.
(2) Unless otherwise indicated, this and all following translations are my own.
(3) In the translation the capitalization of the letters A, C, G, T has been omitted for clarity. I would also like to thank Hanne Hügel, Andrea Lowe, Hella Eichhoff, and Regine von Teichmann for their valuable suggestions in the translation of this and the following poem.
(4) As William P. Malm points out, the term nagauta has two meanings. In its earliest usage, in the classical Japanese collection of poetry called Manyōshū (circa A.D. 760), it refers "to poems of greater than usual length." However, it later refers to the shamisen music form in kabuki theatre (which first appeared in Japan at the beginning of the seventeenth century) (3).
(5) The following list of key concepts of American transcendentalism is not exhaustive. For an overview of American transcendentalism in German, see Zapf 98-110. For an introduction in English see, for example, Rose.
BIBLIOGRAPHY
British Broadcasting Corporation. 27 Dec. 2001. The World Today. Euro Special, 2001, 1 May 2005 <http://www.bbc.co.uk/worldservice/programmes/twt_euro/euro_twt.shtml>.
Hausemer, Georges. Apropos ... Literatur in Luxemburg. Luxembourg: Service Information et Presse du gouvernement luxembourgeois, 2004.
Helminger, Nico. einer blättert im fahndungsbuch. gedichte . Berlin: edition kontext, 1979.
--. landschaft mit seilbahn. Gedichte. Echternach: éditions phi, 1986.
--. hugo’s balls. adda-verlag, 1992.
--. Patton & Co. Gedichte. Echternach: éditions phi, 1992.
--. In eigener Säure. sequenzen. Echternach: éditions phi, 1996.
--. "A Question About Bridges." 27 Dec. 2001, The World Today. Euro Special. British Broadcasting Corporation, 2001, 1 May 2005, <www.bbc.co.uk/worldservice/programmes/twt_euro/euro_helminger.html > .
--. grenzgang. sequenzen. Esch/Alzette: éditions phi, 2003.
Higert, Romain. "bischöfe in der luft und leithammel in den wiesen. Deutschsprachige Lyrik in Luxemburg." Luxemburgensia 7 Nov. 2003. 1 May 2005 <http://www.land.lu/html/dossiers/dossier_luxemburgensia/lyrik_310103.html>.
Honnef, Becker, Irmgard and Peter Kühn, eds. Über Grenzen. Literaturen in Luxemburg . Esch/Alzette: éditions phi, 2004.
Jameson, Frederic. Postmodernism, or, the Cultural Logic of Late Capitalism. Durham, NC: Duke University Press, 1991.
Kramer, Johannes. "’Tri-Literalität’ in der Literatur in Luxemburg." Über Grenzen. Literaturen in Luxemburg. Ed. Irmgard Honnef-Becker and Peter Kühn. Esch/Alzette: éditions phi, 2004, 27-55.
Malm, William P. Nagauta: The Heart of Kabuki Music . Tokyo: Tuttle, 1963.
Manderscheid, Roger. Schacko Klak: Biller aus der Kandheet (1935-1945). Echternach: éditions phi, 1988.
Raus, Michel. "’Nichts ist wie...’. Zu neuer Lyrik von Nico Helmninger: grenzgang." Luxemburgensia 7 Nov. 2003. 1 May 2005 < http://www.land.lu/html/dossiers/dossier_luxemburgensia/helminger_071103.html>.
Rilke, Rainer Maria. Duineser Elegien . Zürich: Manesse, 81991.
Rose, Anne. Transcendentalism as a Social Movement, 1830-1850. New Haven: Yale University Press, 1981.
Strasser, Alfred. "Der Dichter als Gehzeug." Krautgarten 44 (2004): 68.
Zapf, Hubert, ed. Amerikanische Literaturgeschichte. Stuttgart: Metzler, 1996.
5.6. Border Zones: Travel, Fantasy and Representation
Sektionsgruppen | Section Groups | Groupes de sections
Inhalt | Table of Contents | Contenu 16 Nr.